POJ 1007 DNA Sorting

DNA Sorting

Time Limit: 1000MS Memory Limit: 10000KTotal Submissions: 80676 Accepted: 32471

Description

One measure of ``unsortedness'' in a sequence is the number of pairs of entries that are out of order with respect to each other. For instance, in the letter sequence ``DAABEC'', this measure is 5, since D is greater than four letters to its right and E is greater than one letter to its right. This measure is called the number of inversions in the sequence. The sequence ``AACEDGG'' has only one inversion (E and D)---it is nearly sorted---while the sequence ``ZWQM'' has 6 inversions (it is as unsorted as can be---exactly the reverse of sorted). 

You are responsible for cataloguing a sequence of DNA strings (sequences containing only the four letters A, C, G, and T). However, you want to catalog them, not in alphabetical order, but rather in order of ``sortedness'', from ``most sorted'' to ``least sorted''. All the strings are of the same length. 

Input

The first line contains two integers: a positive integer n (0 < n <= 50) giving the length of the strings; and a positive integer m (0 < m <= 100) giving the number of strings. These are followed by m lines, each containing a string of length n.

Output

Output the list of input strings, arranged from ``most sorted'' to ``least sorted''. Since two strings can be equally sorted, then output them according to the orginal order.

Sample Input

10 6AACATGAAGGTTTTGGCCAATTTGGCCAAAGATCAGATTTCCCGGGGGGAATCGATGCAT

Sample Output

CCCGGGGGGAAACATGAAGGGATCAGATTTATCGATGCATTTTTGGCCAATTTGGCCAAA

代码：

<span style="font-size:14px;">import java.util.Arrays;import java.util.Scanner;public class P1007_DNASorting {private static class DNA implements Comparable{private int inversionnum;private  String dnasq;@Overridepublic int compareTo(Object o) {DNA dna=(DNA)o;if(this.inversionnum>dna.inversionnum)return 1;else if(this.inversionnum<dna.inversionnum)return -1;else return 0;}}public static void main(String[] args) {Scanner in = new Scanner(System.in);int len=in.nextInt();int T=in.nextInt();DNA[] dna=new DNA[T];int[] n= new int[4];for(int i=0;i<T;i++){dna[i]=new DNA();dna[i].dnasq=in.next();dna[i].inversionnum=inversionNumber(dna[i].dnasq,len);}Arrays.sort(dna);for(int i=0;i<T;i++){System.out.println(dna[i].dnasq);}}public static int inversionNumber(String s,int len){int ans=0;int A,C,G;A=C=G=0;for(int i=len-1;i>=0;i--){switch(s.charAt(i)){case 'A':{A++;break;}case 'C':{C++;ans+=A;break;}case 'G':{G++;ans+=A+C;break;}case 'T':{ans+=A+C+G;break;}}}return ans;}}</span>