Poj 1007



DNA Sorting

Description

One measure of ``unsortedness'' in a sequence is the number of pairs of entries that are out of order with respect to each other. For instance, in the letter sequence ``DAABEC'', this measure is 5, since D is greater than four letters to its right and E is greater than one letter to its right. This measure is called the number of inversions in the sequence. The sequence ``AACEDGG'' has only one inversion (E and D)---it is nearly sorted---while the sequence ``ZWQM'' has 6 inversions (it is as unsorted as can be---exactly the reverse of sorted).

You are responsible for cataloguing a sequence of DNA strings (sequences containing only the four letters A, C, G, and T). However, you want to catalog them, not in alphabetical order, but rather in order of ``sortedness'', from ``most sorted'' to ``least sorted''. All the strings are of the same length.

Input

The first line contains two integers: a positive integer n (0 < n <= 50) giving the length of the strings; and a positive integer m (0 < m <= 100) giving the number of strings. These are followed by m lines, each containing a string of length n.

Output

Output the list of input strings, arranged from ``most sorted'' to ``least sorted''. Since two strings can be equally sorted, then output them according to the orginal order.

Sample Input

10 6AACATGAAGGTTTTGGCCAATTTGGCCAAAGATCAGATTTCCCGGGGGGAATCGATGCAT

Sample Output
CCCGGGGGGAAACATGAAGGGATCAGATTTATCGATGCATTTTTGGCCAATTTGGCCAAA
#include<iostream>#include<string>using namespace std;struct DNA{int num[99];string test[100];};int main(){DNA real;int m, n;cin >> m >> n;if (0<m&&m <= 50 && 0<n&&n <= 100){cin.get();for (int i = 0; i < n; i++){getline(cin, real.test[i]);}for (int i = 0; i < n; i++){real.num[i] = 0;for (int j = 0; j < m; j++){for (int z = j + 1; z < m; z++){if (real.test[i][j] > real.test[i][z]){real.num[i]++;}}}}for(int i=0;i<750;i++){int num=0;if(num!=n){for(int j=0;j<n;j++){if(i==real.num[j]){cout<<real.test[j]<<endl;num++;}}}}}return 0;}