LeetCode187——Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",Return:["AAAAACCCCC", "CCCCCAAAAA"].

实现：

class Solution {
public:
    vector<string> findRepeatedDnaSequences(string s) {
        vector<string> vs;
        char hash[1048575] = {0};
        if (s.size() < 11) return vs;
        int len = s.size();
        int flag = 0;
        for (int i = 0; i < 9; i++) {
            flag = flag << 2 | (s[i] - 'A' + 1) % 5;
        }
        for (int i = 9; i < s.size(); i++) {
            if (hash[(flag= flag << 2 | (s[i] - 'A' + 1) % 5)&0xfffff]++ == 1) {
                vs.push_back(s.substr(i-9, 10));
            }
        }
        return vs;
    }
};