Calling SNPs/INDELs with SAMtools/BCFtools
来源:互联网 发布:大数据魔镜 编辑:程序博客网 时间:2024/06/05 11:31
Calling SNPs/INDELs with SAMtools/BCFtools
The basic Command line
Suppose we have reference sequences in ref.fa, indexed by samtools faidx, and position sorted alignment files aln1.bam and aln2.bam, the following command lines call SNPs and short INDELs:
- samtools mpileup -uf ref.fa aln1.bam aln2.bam | bcftools view -bvcg - > var.raw.bcf
- bcftools view var.raw.bcf | vcfutils.pl varFilter -D100 > var.flt.vcf
Since r865, it is possible to generate the consensus sequence with
- samtools mpileup -uf ref.fa aln.bam | bcftools view -cg - | vcfutils.pl vcf2fq > cns.fq
Understanding the command line
In the command line above, samtools collects summary information in the input BAMs, computes the likelihood of data given each possible genotype and stores the likelihoods in the BCF format (see below). It does not call variants.
Bcftools applies the prior and does the actual calling. It can also concatenate BCF files, index BCFs for fast random access and convert BCF to VCF. In addition, bcftools can operate on some VCFs (e.g. calling SNPs from GL-tagged VCFs), but not for all VCFs; VCF to BCF conversion is not working at the moment, either.
Tuning the parameters
One should consider to apply the following parameters to mpileup in different scenarios:
- Apply -C50 to reduce the effect of reads with excessive mismatches. This aims to fix overestimated mapping quality and appears to be preferred for BWA-short.
- Given multiple technologies, apply -P to specify which technologies to use for collecting initial INDEL candidates. It is recommended to find INDEL candidates from technologies with low INDEL error rate, such as Illumina. When this option is in use, the value(s) following the option must appear in the PL tag in the @RGheader lines.
- Apply -D and -S to keep per-sample read depth and strand bias. This is preferred if there are more than one samples at high coverage.
- Adjust -m and -F to control when to initiate indel realignment (requiring r877+). Samtools only finds INDELs where there are sufficient reads containing the INDEL at the same position. It does this to avoid excessive realignment that is computationally demanding. The default works well for many low-coverage samples but not for, say, 500 exomes. In the latter case, using -m 3 -F 0.0002 (3 supporting reads at minimum 0.02% frequency) is necessary to find singletons.
- Use `-BQ0 -d10000000 -f ref.fa' if the purpose is to get the precise depth of coverage rather than call SNPs. Under this setting, mpileup will count low-quality bases, process all reads (by default the depth is capped at 8000), and skip the time-demanding BAQ calculation.
- Apply -A to use anomalous read pairs in mpileup, which are not used by default (requring r874+).
Understanding the output: the VCF/BCF format
The VCF format
The Variant Call Format (VCF) is the emerging standard for storing variant data. Originally designed for SNPs and short INDELs, it also works for structural variations.
VCF consists of a header section and a data section. The header must contain a line starting with one '#', showing the name of each field, and then the sample names starting at the 10th column. The data section is TAB delimited with each line consisting of at least 8 mandatory fields (the first 8 fields in the table below). The FORMAT field and sample information are allowed to be absent. We refer to the official VCF spec for a more rigorous description of the format.
The BCF Format
BCF, or the binary variant call format, is the binary version of VCF. It keeps the same information in VCF, while much more efficient to process especially for many samples. The relationship between BCF and VCF is similar to that between BAM and SAM. The detailed format description of the BCF format can be found in bcf.tex included in the samtools source code package.
SAMtools/BCFtools specific information
SAMtools/BCFtools may write the following tags in the INFO field in VCF/BCF.
- For a read, suppose the k-th base is overlapping the reference base we are looking at. The tail distance for this read equals min{k-1,l-k} where l is the length of the read. If tail distance is small, the difference on the read may be caused by undetected indels.
- In the BCF generated by SAMtools, an non-ref base 'X' represents an base has not been seen from the alignment data. Such a base is necessary to evaluate the probability of missing a non-ref allele due to sampling fluctuation.
- FQ is computed by taking a folded prior (i.e. p'(k)=[p(k)+p(n-k)]/2). It measures if the locus is polymophic among samples. The vcf2fq command replies on this annotation.
- SAMtools/BCFtools writes genotype likelihoods in the PL format which is a comma delimited list of phred-scaled data likelihoods of each possible genotype. For example, suppose REF=C and ALT=A,G, PL=7,0,37,13,40,49 means for the sample we are looking at, P(D|CC)=10^{-0.7}, P(D|CA)=1, P(D|AA)=10^{-3.7}, P(D|CG)=10^{-1.3}, P(D|AG)=1e-4 and P(D|GG)=10^{-4.9}. This ordering has been changed since r921.
- PC2, PCHI2 and QCHI2 are only present with `view -1' is set.
Performing Association Test
The following command performs association test:
- samtools mpileup -uf ref.fa all-aln.bam | bcftools view -vcs xxx -1 yyy - > out.vcf
To further calibrate P-value, one may perform a permutation test with the `-U' option. The `RP' INFO field will give the number of permutations which yield a smaller PCHI2 test statistics. Permutation test is very slow, due to the genotype ambiguity in sequencing data.
Estimating the Allele Frequency Spectrum
While calling SNPs, bcftools will print the estimated AFS to the error output at lines starting with [afs]. However, to accurately estimate AFS, we need to iterate the procedure. In most applications, we are only interested in the AFS conditional on a list of loci. Suppose we have the list of loci in file cond.txt with the first two columns in the file giving the coordinates, the procedure to estimate AFS is:
- bcftools view -NIbl cond.txt data.bcf > cond.bcf
- bcftools view -cGP cond2 cond.bcf > round1.vcf 2> round1.afs
- bcftools view -cGP round1.afs cond.bcf > /dev/null 2> round2.afs
- bcftools view -cGP round2.afs cond.bcf > /dev/null 2> round3.afs
- ......
Another way to estimate AFS is to get the list of site allele frequency by
- perl -ne 'print "$1\n" if /AF1=([^,;]+)/' round1.vcf
Base Alignment Quality (BAQ)
Base Alignment Quality (BAQ) is a new concept deployed in samtools-0.1.9+. It aims to provide an efficient and effective way to rule out false SNPs caused by nearby INDELs. The following shows the alignments of 6 reads by a typical read mapper in the presence of a 4bp homozygous INDEL:
coor 12345678901234 5678901234567890123456 ref aggttttataaaac----aattaagtctacagagcaacta sample aggttttataaaacAAATaattaagtctacagagcaacta read1 aggttttataaaac****aaAtaa read2 ggttttataaaac****aaAtaaTt read3 ttataaaacAAATaattaagtctaca read4 CaaaT****aattaagtctacagagcaac read5 aaT****aattaagtctacagagcaact read6 T****aattaagtctacagagcaacta
where capital bases represent differences from the reference and underlined bases are the inserted bases. The alignments except for read3 are wrong because the 4bp insertion is misplaced. The mapper produces such alignments because when doing a pairwise alignment, the mapper prefers one or two mismatches over a 4bp insertion. What is hurting more is that the wrong alignments lead to recurrent mismatches, which are likely to deceive most site-independent SNP callers into calling false SNPs.
One way to avoid such an artifact is to do multi-sequence realignment, but the current implementations are very computationally demanding. SAMtools seeks another solution. It assigns each base a BAQ which is the Phred-scaled probability of the base being misaligned. BAQ is low if the base is aligned to a different reference base in a suboptimal alignment, and in this case a mismatch should contribute little to SNP calling even if the base quality is high. With BAQ, the mismatches in the example above are significantly downweighted. SAMtools will not call SNPs from that.
The BAQ strategy is invoked by default in mpileup. To make other SNP callers take advantage of BAQ, one should run
- samtools calmd -Abr aln.bam ref.fa > aln.baq.bam
Limitations
- BCFtools does not properly handle multi-allelic variants. It only takes the strongest non-reference allele.
- SAMtools does not properly compute the likelihoods of multi-allelic INDELs.
- The VCF file produced by BCFtools does not strictly conform the VCF spec. For example, the GT genotype information is not always present because for the purpose of BCF, GT is unnecessary and takes disk space. In addition, GT is not the first as is required by the VCF spec. This can be fixed by the bcf-fix.pl script that comes with the source code package, and will be fixed in future (fixed in r880+).
Appendix: Use Cases
SNP/INDEL calling for hundreds of exomes
The following shows the detailed procedure on how to call SNPs/INDELs for hundreds of exomes. It only aims to provide an overview of how to handle huge data sets. Some command lines given below may not work for all systems. Advanced users may also want to modify based on their own system configurations.
In the following, the key and the most difficult part is the command line calling samtools mpileup. Once that is done, one can use 3rd party tools or write their own scsripts to achieve the rest.
Input and preparation
- Obtain auxiliary scripts/programs: array job submission script asub, basic BED processing utility bedutils.pl,alphanumeric sort and tabix:
- export PATH="$HOME/bin:$PATH"
- wget http://lh3lh3.users.sourceforge.net/download/asub
- wget http://lh3lh3.users.sourceforge.net/download/bedutils.pl
- cp asub bedutils.pl $HOME/bin
- wget http://lh3lh3.users.sourceforge.net/download/sort-20101217.tar.bz2
- tar -jxf sort-20101217.tar.bz2
- (cd sort-20101217; make; cp sort $HOME/bin/sort-alt)
- wget http://sourceforge.net/projects/samtools/files/tabix/tabix-0.2.3.tar.bz2/download
- tar -jxf tabix-0.2.3.tar.bz2;
- (cd tabix-0.2.3; make; cp tabix bgzip $HOME/bin)
- Check out a more recent version of samtools
- svn co https://samtools.svn.sourceforge.net/svnroot/samtools/trunk/samtools
- (cd samtools; make; cp samtools bcftools/{bcftools,vcfutils.pl} $HOME/bin)
- The reference sequence file ref.fa. To avoid potential mistakes, ref.fa is better the one that is used for read mapping. File ref.fa should be indexed by samtools' faidx, if this has not been done.
- samtools faidx ref.fa
- File bam.list which gives the paths of indexed BAM files, one line per file. These files should be better tagged with read groups; if not, one BAM per sample.
- File target.bed which gives the target regions in the BED format.
Procedure
- Calling SNPs/INDELs in small regions
- vcfutils.pl splitchr -l 500000 | xargs -i \
- echo samtools mpileup -C50 -m3 -F0.0002 -DSuf ref.fa -r {} -b bam.list \| bcftools \
- view -bcvg - \> part-{}.bcf | aub -j run-part
- Merge regionsTo make sure merge.bcf is correctly generated, one should use bcftools view to retrieve data towards the end of the last chromosome. If something goes wrong in data processing, no data will be retrieved. When we confirm merge.bcf is correct, we may delete intermediate files part-*.bcf and chr-*.bcf.
- cut -f1 ref.fa.fai | xargs -i echo grep ^part-{} \| sort-alt -N \| xargs \
- bcftools cat \> chr-{}.bcf
- awk '{print "chr-"$1".bcf"}' ref.fa.fai | xargs bcftools cat > merge.bcf
- bcftools index merge.bcf
- Extract target regionsHere we use tabix to retrieve target regions, which is a little complicated. In future new functionality may be added to bcftools to simplify this step.
- bcftools view -G merge.bcf | vcfutils.pl varFilter -w0 -10 -20 -30 -40 -Q0 \
- | bgzip > merge.vcf.gz
- tabix -fpvcf merge.vcf.gz
- sort-alt -k1,1N -k2,2n target.bed | bedutils.pl union \
- | awk '{print $1":"($2+1)"-"$3}' | xargs tabix merge.vcf.gz \
- | bgzip > target.vcf.gz
- bcftools view -bl target.vcf.gz > target.bcf
- Filtering. For now, an effective way of filtering is unknown. For indels, one may consider the following:although more effective filters may be existing. For INDELs, one may use the fraction of frameshift indels as a proxy to specificity.
- bcftools view -GM target.bcf | grep INDEL \
- | vcfutils.pl varFilter -10 -20 -30 -40 -a4 -G90 -S30